JCC07514

JOU= RNAL OF CULTURE COLLECTIONS

Volume 5, 2006= -2007, pp. 94-101

NEW CUCUMOVIRU= S ON BEANS IN BULGARIA –

AN ATTEMPT FOR CHARACTERIZATION

Dimitrina Kostova^1*, Stefanos Tsorlianis², Angela Yordanova³,

Vittoria<= /span> Lisa⁴ and Anna-M= aria Vaira⁴

¹Maritsa Vegetable Crops Research Institut= e, 32 Brezovslo shose str., 4003 Plovdiv, Bulgaria;

²Agrarian University, 12 Mendeleev blvd., = 4000 Plovdiv, Bulgaria,³National Bank for Industrial Microorganisms and Cell Cultures, 1113 Sofia, P.O.Box 239, Bulgaria;
⁴Istituto di Virologia Vegetale del CNR (IVV), Strada delle Cacce 73, I-10135 Torino, Italy

*Corresponding author, e-mai= l: dkostova2000@yahoo.com

Summary

A virus was isolated from naturally infected bean plants, grown in d= ifferent areas in Bulgaria. The investigated isolates were characterized using electron microscopy, serology, biological tests, electrophoretic analysis and reverse transcript= ion-polymerase chain reaction (RT-PCR). Isometric particles ab= out 30 nm in diameter were observed in crude sap preparations. The tested isolates were serologically distantly related to cucumber mosaic virus (CMV) but in ELISA experiments and immuno-electrophoresis they demonstrated a close serological relationship with a cucumovirus from China named Ch 39. The Bulgar= ian isolates were identified as a cucumovirus Ch 39-BG. The electrophoretic analysis of this virus showed the presence of two protein bands. CMV primers amplified an unspecific DNA fragment of 500 bp. All the performed investiga= tions suggested the presence of a cucumovirus closer to CMV though different from= the known CMV strains.

Key words: cucumovirus, bean, electron microscopy, ELISA, immunoelectrophoresis, SDS-P= AGE, RT-PCR.

Introduction

The genus Cucumovirus= , belonging to the Bromoviridae family, comprises three viruses: cucumber mosaic virus (CMV) - t= he type species, tomato aspermy vir= us (TAV) and peanut s= tunt virus (PSV) [13, 24]. Cucumoviruses are distributed worldwide and include numerous strains. Virions are isometric (29-30 nm in diameter) and contain one structural protein.

A great similarity in characteristics between CMV, PSV= from one side [5, 21] and TAV from the other [11, 27] supports the union of these three viruses in one gr= oup. A comparative serological study of a large number of isolates of CMV, PSV and TAV has also led to the establishment of relationships among these viruses and a possibility of breeding “new” strains [6, 7= ]. Some researchers succeeded to construct infectious viruses through recombin= ation of genomic segments of CMV with complementary parts of either the PSV [18] or TAV genome [11], = which confirmed the close relationships between these viruses. =

<= span lang=3DEN-US style=3D'mso-ansi-language:EN-US'>As a result of the investiga= tion on bean viruses in Bulg= aria, a new virus was isolated from bean plants with severe mosaic symptoms. The = aim of the present study is to characterize this virus using different methods: electron microscopy, serology, biological tests, electrophoretic analysis a= nd reverse transcription-polymerase = chain reaction (RT-PCR).=

Materials and Methods

Investigated virus isolates. Three virus isolates from naturally infe= cted bean plants (No 75, 77 and 113), collected from 3 production regions (Marko= vo, Hrabrino and Plovdiv), were investigated. They were propagated and maintained in Phaseolus vulgaris in a growing chamber at temperatures 24 = ;^oC/16 ^oC (day/night). The isolates No 75, 77 and 113 were deposited in National Bank= for Industrial Microorganisms and Cell Cultures, Sofia (NBIMCC 3690, 3691, 3692= ). Strain B1, isolated by Dr. V. Lisa from bean in Bulgaria and related to CMV [= 15, 28] (NBIMCC 3330), was also tested in some comparative investigations. The virus isolates were preserved by freeze-drying according to Donev et al. [9= ].

Virus purification. The tested isolates we-re purified by the method of Lot et al. [17], with some modifications. Virus preparations, obtain-ed after one cycle of differential centrifugation, were used in electrophoretic and immunoelectrophoretic analyses.

Host plants. Biological characterization of the studied isola= tes was carried out on 16 plant species: Chenopodium quinoa, C. amaranticolor, P. vulgaris cv. Dubbele Witte, Nicotiana bentamiana, N. clevelandii, = N. glutinosa, N. tabacum cv. White Burley, Gomphrena globosa, Datura stramonium, Petunia hybrida, Lycopersicon esculentum, Cucumis sativus, Pisum sativum, and Vicia faba. Inoculation was done using systemically infected be= an leaves ground in ice-cold 1 % K₂HPO₄ solution, containing 0.1 % Na₂SO₃ (ratio 1:1 w/v). Carboru= ndum 600 mesh was used as an abrasive. Plants we-re scored at weekly intervals.<= o:p>

Electron microscopy.<= /b> Immunosorbent electron micr= oscopy (ISEM) methods of attracttion and decoration were used [20]. The following = polyclonal antibodies (PAbs) from Istituto di Virologia Veg= etale del CNR (IVV), Torino, were used: Antiserum (AS) 326 and AS 343 against CMV; AS 52 against= broad bean mottle bromovirus (BBMV); <= /span>AS 263 - brome mosaic bromovirus (BMV); AS 287 - melandrium yellow fleck bromovirus (MYFV); AS 229 - broad bean stain comovirus (BBSV); AS 157 -= southern bean mosaic sobemovirus (SBMV)= .

Enzyme-linked immunosorbent assay (ELISA). Different ELISA methods were used: plate-trapped antigen (PTA)-ELISA, double antibody sandwich (DAS)-ELISA and triple anti-body sandwich (TAS)-ELISA [4, 10].

PTA-ELISA. Samples were grou= nd in carbonate coating buffer at dilution 1:100. An universal PAb against CMV (AS 326) diluted 1:1000 was used in the assay. Antispecies antibody AP-conjugate was used as specified by manufacturer (Sigma).

DAS-ELISA. Plates were coate= d with CMV PAbs - ALS and CMV S4 from DLO-Research Institute for Plant Protection = (IPO-DLO), Wageningen, The Netherlands. An antiserum, provisionally named= Ch 39, was also used. It was raised against a cucumovirus, isolated from P. vulgaris in northern China by Dr. V. Lisa in 1990 (P. Roggero, V. Lisa and G. Dellavalle, personal communication). The PAbs were used at dilution 1:1000. The virus samples we= re applied at dilution 1:100 and the specific AP-co-njugate - 1:400.

TAS-ELISA. Th= e CMV PAbs were used at a concentration of 1 mg/ml in coating buffer. At the next step plates were loaded with samples diluted 1:100. CMV monoclonal antibodies (MAbs) we= re used at dilution 1:1000. Rabbit anti-mouse IgG-AP-conjugate was used at a dilution 1:10000. The CMV MAbs 2+185, M85 and M172 were from IVV, Torino, Italy and CMV MAb Agdia from Horticulture Research International (HRI), Wellesbourne, U.K.

In ELISA the colour reaction= was developed by adding 0.4 mg/ml p-nitrophenylphosphate in diethanolamine buff= er, pH 9.8. Absorbance values were read at 405 nm and considered positive when exceeded three times those of the mean healthy controls.<= /p>
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)= . The molecular weight of the = capsid protein (CP) was estimated by SDS-PAGE according to Laemmli [16]. The electrophoresis was done in 15 % resolving gel at 22 mA for 1.5 h. The gels were stained with Coomassie Brilliant Blue R-250. LMW electrophoresis calibration kit (Pharmacia) was used as a standard. Purified preparations f= rom the collection of the NBIMCC were used as control strains: CMV Fny - I subg= roup [26], CMV GR - II subgroup; tobacco mosaic virus (TMV) type strain U1.=

Counter immunoelectrophoresis. Counter immunoelectrophoresis was carried= out in 0.9 % agarose gel in 0.075 M veronal buffer, pH 8.6, containing 5 mM EDTA, at 150 V, 1= 0 ^oC for 2.5 h. AS Uo, raised against= CMV [29] was applied in this assay as well as AS Ch39. CMV Fny was used as a control strain. Plates were stain-ed with Coomassie Brilliant Blue R-250 [29].=

RT-PCR and RFLP (restriction fragment length polymorphism) analysis.= The amplification of the CP= gene cDNA was done according to the protocols described by Rizos et al. [25]. The primers used were: 5’CP (5’ CTCGAATTCGGATCCGCTTCTCCGCGAG <= st1:metricconverter ProductID=3D"3’" w:st=3D"on">3’), corresp= onding to the nucleotide region from 1149 to 1161 and 3’CP (5’ GGCGAATTCGAGCTCGCCGTAAGCTGGATGGAC 3’) - to the nucleotide region from 1998 to 2015 of CMV-Q RNA-3. These primers amplify a product of about 870 bp with CMV isola= tes [25]. The amplified PCR products were separated in a 1.5 % agarose gel= in TBE buffer and stained with ethidium bromide. As a size marker fX174 DNA/Hae III was used (Boehringer). Restriction digest of the PCR pro-ducts was performed using the restriction endonuclease MspI (Gibco, BRL) [25].

Results

Electron Micro= scopy

<= span lang=3DEN-US style=3D'mso-ansi-language:EN-US'>Isometric particles about 30= nm in diameter were observed in crude sap preparations from naturally infected pl= ants (isolates No 75 and 77). A small number of similar particles was found in t= he same preparations trapped on grids coated with 4 antisera raised against several isometric viruses (Table 1). The largest number of trapped virions = was established with AS against BMV (about 100), whereas with CMV AS it was 15-20. Grids, treated with AS against BBSV and SBMV did not attract particles. No decoration was observed after incubation on grids coated with= all the 6 antisera (Table 1).

= Ta= ble 1. ISEM of virus isolates No 75= and 77 with different antisera.=

AS

Isolate Nо 75

Isolate Nо 77

Attraction

Decoration

Attraction

Decoration

AS 52 - BBMV

30 particles
per field

few particles,
no decoration

25 particles per field

few particles,
no decoration

AS 263 - BMV

100 particles
per field

20 particles per field, no decoration

92 particles per field

20 particles per field,
no decoration

AS 287 - MYFV=

10 particles
per field

virus is seen,
no decoration

10 particles per field

virus is seen,
no decoration

AS 326 - CMV<= /span>

20 particles
per field

virus is seen,
no decoration

15 particles per field

virus is seen,
no decoration

AS 229 - BBSV

-

-

-

-

AS 157 - SBMV

-

-

-

-

Control with buffer

400 particles
per field

-

320 particles per field

-

Note: AS dilution 1:1000; colour reaction= - uranil acetate; (-), no virus particles.

Host range

The virus isolates were easi= ly transmitted to the inoculated plant species (Table 2). Usual systemic sympt= oms were mosaic, yellow or necrotic spots, followed in some cases by systemic necrosis or stunting in the growth. It is worth to emphasize the systemic spread of the three isolates in C.&= nbsp;quinoa and C. amaranticolor (Table 2).

Table 2. Biological te= st with virus isolates No 75, 77 and 113.

Isolates<= /span>

C. qui-noa

C. ama-ranticolor

P .vulgaris
cv
.D. Witte

N. bentha-
miana

N. cle-velandii

N. glu-tinosa

N. tabacum
cv.
W. Burley

G. glo-bosa

75

*/YS

*/YS

DCS E/
St M

DCS/M

DCS/M

SNS/M St

SNS/M St

SNS/M St

77

*/YS

ns/YS

DCS E/
St M

ns/M LD E<= /o:p>

n.t.

ns/M LD

CRS/M Bls=

RNS/
RNS LD

113

*/YSp

*/YSp

DCS E/
St M

ns/M St

ns/M

SCRS/
LD FF

CRS/ns

n.t.

CMV
control

CLL/ns

CLL/ns

DCS E/M

ns/M

ns/M

ns/M

n.t.

ns/ns

Legend:&n= bsp;primary/systemic symptoms ( / ), no sympto= ms (ns), chlorotic local lesions (CLL), single chlorotic spots (SCS), diffuse chlorotic spots (DCS), chlorotic spots (CS), single chlorotic spots (SCS= ), chlo= rosis (Ch), epynasty (E), necrotic spots (NS), small necrotic spots (SNS), redish necrotic spots (RNS), leaf abscission (LA), mottling (Mo), clear mottling (CMo), mosaic (M), severe mosaic (SM), yellow spots (YS), yellow local lesions (YLL), yellowing (Y), leaf curling (LC), blisters (Bls), leaf deformation (LD), filiform leaves (FF), stunting (St), wilting (W), systemic black necrosis (SBN), symptom variation between CLL, CS, DCS and YLL (*),not tested (n.t.= ).

Table 2. continued.

Isolates<= /span>

D. stramonium

P. hybrida

L. esculentum

C. annuum

C. sativus

P. sativum

V. faba

75

n.t.

NS/M St= Y

ns/YS

DCS LA/Mo=

ns/ns

ns/ns

SBN

77

n.t.

n.t.

ns/ns

ns/ns

ns/ns

Chl/LC
LD St W

SBN

113

n.t.

n.t.

ns/ns

ns/ns

ns/ns

Chl/LC
LD W

SBN

CMV

control=

DCS/SCS

n.t.

ns/ns

ns/ns

ns/M

ns/ns

n.t.

Legend:&n= bsp;primary/systemic symptoms ( / ), no sympto= ms (ns), chlorotic local lesions (CLL), single chlorotic spots (SCS), diffuse chlorotic spots (DCS), chlorotic spots (CS), single chlorotic spots (SCS= ), chlo= rosis (Ch), epynasty (E), necrotic spots (NS), small necrotic spots (SNS), redish necrotic spots (RNS), leaf abscission (LA), mottling (Mo), clear mottling (CMo), mosaic (M), severe mosaic (SM), yellow spots (YS), yellow local lesions (YLL), yellowing (Y), leaf curling (LC), blisters (Bls), leaf deformation (LD), filiform leaves (FF), stunting (St), wilting (W), systemic black necrosis (SBN), symptom variation between CLL, CS, DCS and YLL (*),not tested (n.t.= ).

Serology<= /o:p>

In PTA-ELISA virus isolates = were positive for CMV, whereas in DAS- and TAS-ELISA the samples were negative f= or the same virus (Table 3).

Surprisingly, all virus isol= ates reacted positively in PTA- and DAS-ELISA with AS Ch 39. The cucumovirus Ch = 39 was distantly related to subgroups I and II of CMV and more closely related to = TAV and PSV (P. Roggero, V. Lisa and G. Dellavalle, personal communication). The presented results suggested a cucumovirus, serologically related to that isolated in China (Table 4). It was designated as cucumovirus Ch 39-BG.

Table 3. PTA-, DAS- and TAS-ELISA of three bean isolates (No 75, 77 and 113), using PAbs and MAbs against CMV.=

Isolates

PTA-ELISA (PAb)=

= DAS-ELISA (PAbs)

= TAS-ELISA* (MAbs)

AS 326

AS ALS

AS = S4

M85=

M172

Agdia

= 75

+

-

-

-

-

-

= 77

+

-

-

-

-

-

= 113

+

-

-

-

-

-

= Positive

= CMV control

+++

++

+++

++

++

+++

Legend: &= lt;0.25 (+), <= /span>0.25–0.6 (++), = 0.65 – 1.0 (+++), >1.0 OD (++++).

* = In TAS-ELISA plates were coated with AS 326.

=

= Table 4. ELISA of isolates N= o 75 and 77, using AS Ch 39.

Isolates=

PTA-ELISA

DAS-ELISA

TAS-ELISA*

AS Ch 39=

CMV AS 326

AS Ch 39=

CMV MAb 2+185

75=

+++

++

++

-

77=

+++

+

++

-

Positive CMV control

+++

+++

-

++++

Legend: &= lt;0.25 (+), <= /span>0.25–0.6 (++), = 0.65 – 1.0 (+++), >1.0 OD (++++).

* = In TAS-ELISA plates were coated with AS Ch39.

Partially purified preparations of cucumovirus Ch 39-BG (No 77, 113), isolate B1 and the control CMV strain Fny were analyzed by immunoelectrophoresis. When Ch 39-BG isolat= es diffused against CMV AS (Fig. 1a), no precipitin lines were observed. In contrast, Ch 39-BG isolates and B1 as well as CMV Fny gave precipitin bands formation against AS Ch 39 (Fig. 1b).

The results regarding the serological relationships between isolates 77, 113, B1 and CMV Fny are presented in Fig. 1c. Isolate B1 produced an apparent spur over the precipitin line of CMV Fny when diffused against AS Ch 39 (Fig. 1c). N= o spurs were observed between bands from adjacent antigens of B1 and 77 as well as between 77 and 113.

Fig. 1. Immunoelectrophoretic analysis of cucumovirus isolates. <= /p>
Antisera in u= pper holes: CMV (a), Ch39 (b and c).

Antigens: hea= lthy plant sap (1), CMV Fny (2), isolate 77 (3), isolate 113 (4) and isolate B1 = (5).

SDS-PAGE<= /o:p>

The CP of the isolates No 77= , 113 and B1 were subjected to SDS-PAGE (Fig. 2). The three viruses formed two ba= nds with very similar electrophoretic mobility. The molecular weight of these peptids was estimated of about 22 and 28 kDa. Similar bands were obser= ved by V. Mavrodieva with isolate B1 (personal communication).<= /span>

<= o:p>

Fig. 2.&= nbsp;SDS-PAGE of capsid proteins of cucumovirus isolates. Lines: TMV U1 (1), protein mark= ers (2), CMV GR - II subgroup (3), CMV Fny - I subgroup (4), isolate 77 (5), isolate 113 (6), isolate B1 (7), healthy plant (8).

RT-PCR

The investigated cucumovirus isolates amplified a DNA fragment of approximately 500 bp, completely diffe= rent from that of CMV - 872 bp (results are not shown in details). No restrictio= n of the fragment was observed in RFLP analysis using the restriction enzyme Msp= I, whereas the control CMV strains produced a MspI restricttion pattern typical for subgroup I (fragment length 535 and 335 bp) and subgroup II (250, 200, = 160 and 130 bp), respectively.

<= o:p>

Discussion

A cucumovirus was isolated f= rom naturally infected bean plants, grown in different areas in Bulgaria. The virus was identified as a cucu-movirus Ch 39-BG based on a close serological relationship with a cucumovirus from China named Ch 39. The tested Bulgarian isolates demonstrated a strong positive reaction with AS Ch 39 in DAS-ELISA and a negative reaction for CMV in DAS and TAS-ELISA. The positive reaction of the same isolates for CMV in PTA-ELISA could be explained by the ability of the indirect ELISA to detect cucumoviruses that differ by a SDI up to 7 [8]. DAS ELISA is regarded as possessing a narrow specificity allowing discrimination between closely related CMV strains in both subgroups I and II, which gener= ally differ by a SDI of only 1-2 [24]. Immunoelectrophoresis data confirmed the serological identity of the investigated isolates. They seemed closely rela= ted to the Chinese isolate Ch 39 and did not react with = CMV AS.

The biological assay of the cucumovirus isolates did not help much for virus identification but gave so= me characteristics of the new virus. Local and systemic symptoms observed in C. quinoa and C. amaranticolor were of some similarities with PSV [1, 3]. It = is noteworthy that there are CMV isolates causing systemic reaction in C. quinoa [1] where some PSV isolates are localized [30].<= /o:p>

ISEM results proved the pres= ence of isometric but different from CMV particles. The lack of decoration with antisera to BMV, BBMV, and MYFV led to the conclusion that the investigated virus was also different from these viruses and needed further investigatio= n.

SDS-PAGE data were disputabl= e. It is well known that CP of all cucumoviruses has a size of about 24,500 kDa [11]= . It is unlikely to consider the existence of a virus from the cucumovirus group having two protein subunits. Probably, the larger polypeptide is the CP, wh= ich differs considerably in amino acid composition from the cucumovirus CP and therefore manifests lower electrophoretic mobility. The smaller polypeptide could represent a degradation product of CP due to proteolytic activity in = the plant sap during virus extraction [12, 14, 22, 23]. Okuda et al. found two protein bands of a clover yellow vein virus isolate from Japan d= espite the fact that potyviruses possess only one CP [23]. These are questions to = be answered.

RT-PCR results indicated the presence of a virus different from CMV. CMV specific primers amplified a DNA fragment of 500 bp in-stead of 872 bp. In similar experiments with PSV and = TAV isolates, amplification of any DNA fragment did not find [2]. The fact that some product was observed with the CMV primers and our cucumovirus isolates indicates that this virus is closer to CMV rather than to PSV and TAV. A similar fragment of 500 bp was observed also by V. Mavrodieva in RT-PCR of isolate B1 [20]. The same author revealed no homology between the nucleotide sequences of the CP gene of isolate B1 and the CP gene of CMV (personal communication). In SDS-PAGE, isolate B1 formed two bands of 22 and 28 kDa, typical for isolates 77 and 113. In counter immunoelectrophoresis B1 reacted as serologically identical to the tested isolates and expressed stronger relationship to Ch 39 than to CMV. These results are the reason to join B1 isolate to the investigated isolates No 75, 77 and 113. <= /p>
In conclusion, all the perfo= rmed investigations suggested the existence of a cucumovirus different from the known CMV strains. The fact that the three isolates studied were identical = to the isolate B1, found on beans more than 15 years ago, indicate that this v= irus was spread on beans in Bulgaria long time ago.

References=

1. Ahmad, I. B., H. A. Scott, 1985. Plant Dis., 69, 891-893.

2. An= onymous, 1998. J. Plant Pathology, 80 (2), 133-149.

3. Bananej, K., M. R. Hajimorad= , M. J. Roossinck, N.Shahraeen, 1998. Plant Pathol., 47, 355-361.=

4. Be= njamini, E., S. Leskowitz, 1992. Immunology: A Short Course, 2 edn, Ne= w York: Wiley-Liss.

5. Bo= atman, S., J. M. Kaper, S. A. Tolin, 1973. Phytopathology, 61, 801 (abstract).

6. De= vergne, J. C., L. Cardin, 1973. Ann. Phytopathol., 5, 409–430.

7. De= vergne, J. C., L. Cardin, 1976. Ann. Phytopathol., 8, 449–= ;459.

8. Devergne, J. C., L. Cardin, = J. Burckard, M.H. V. Van Regenmortel, 1981. J. Virol. Methods, 3, 193-200= .

9. Donev, T., A. Yordanova, E. Stoimenova, S. Damjanova, 1996. Biotechnol. Tech., 10, 971-976.

10. Cl= ark, M. F., A. N. Adams, 1977. J. Gen. Virol., 34, 475-483.

11. Ha= bili, N., R. I. B. Francki, 1974. Virology, 57, 392–401.

12. Hi= ll, J., R. J. Shepherd, 1972. Virology, 47, 817-822.

13. Ka= per, J. M., H. E. Waterworth, 1981. Cucumoviruses. In: Handboo= k of Plant Virus Infections and Comparative Diagnosis, E. Kurstak (Ed.), New York: Elsevier/North Holland Biomedical Press, 257-332.=

14. Ko= ening, R., H. Hegemann, H. Franksen, H. L. Paul, 1970. Biochem. Biophys. Acta, 207, 184-189.

15. Kostova, D., I. Porjazov, V.= Lisa, N. Spence, 1995. Plant Science (Sofia), 32 (7-8), 65-68 (in Bulgarian).

16. Laemmli, U. K., 1970. Nature, 227, 680-685.

17. Lot= , H., J. Marrou, J. B. Quiot= , C. Esvan, 1972. Ann. Phytipathol.,= 4, 25-38.

18. Ma= rchoux, G., 1975. Docto= ral Thesis, University of Marseill= e, France.

19. Mavrodieva, V. A., D. J. Bar= bara, N. J. Spence, 1998. IX Congress of the Bulgarian Microbiologists, 15-17 Oct., 1998, Sofia, Proceedings, vol. 3, 549-55= 2.

20. Mi= lne, R., 1970. Electron microscopy of viruses. In: Principl= es and Techniques in Plant Virology, Kado C. I., H. O. Agrawal (Eds), New York: Van No= strand, Reinhold.

21. Mi= nk, G. I., M. J. Silbernagel, K. N. Saksena, 1969. = Phytopathology, 59, 1625–1631.

22. Ni= blett, C.L., J. S. Semancik, 1969. Virology, 38, 685-693.

23. Ok= uda, S., M. Hasegawa, T. Natsuaki, K. Kaji, K.T. Natsuaki, M. Teranaka, 1992.= Ann. Phytopath. Soc. Japa= n, 58, 298-304.=

24.= Palukaitis, P., M. J. Roossinck, R.= G. Dietzgen, R. I. B. Francki, 1992. A= dv. Virus Res., 41, 281–= 348.

25. Rizos, H., L. Gunn, R.D. Par= es, M. R. Gillings, 1992. J. Gen. Virol., 73, 2099-2103.<= /p>
26. Rizzo, T. M., P. Palukaitis,= 1988. J. Gen. Virol., 69, 1777-1787.

27.= Stace–Smith R., J. H. Tremain= e, 1973. Virology, 51, 401–408.

28. Tsorlianis, S., 2001. Identi= fication and characterization of the bean (P= haseolus vulgaris L.) viruses in Bulgaria in connection with the resistance selection, PhD Thesis, Plovdiv (in Bulgarian).

29. Yordanova, A., D. Christova,= V. Mavrodieva, 1999. Plant Science (Sofia), 36, 230-234 (in Bulga= rian).

30.= Zeyong, X., C. M. Higgins, C. Kunro= ng, R. G. Dietzgen, Z. Zhongyi, Y. Liying, F. Xiao-Ping, 1998. Plant Disease, 82, 992-998.

НОВ КУКУМОВИРУi= 7; ПО ФАСУЛА В БЪЛГАРИЯ –=

ОПИТ ЗА ХАРАКТЕРИЗh= 8;РАНЕ

Димитр&#= 1080;на Костова^1*, Стефанос Цорлианис², Анжела Йорданова³= ,

Витори&#= 1103; Лиза⁴, Ана-Мария Ваира⁴

= Резюме

&= #1055;олучени са вирусни изолати от естествено заразени фасулеви растения, отглеждани = 74; различни райони на България. Те са характер = 80;зирани с електронн = 72; микроскопиn= 3;, серологичнl= 0; и биологичн = 80; тестове, електрофорk= 7;тичен анализ и полимеразнk= 2; верижна реакция с обратна тра = 85;скрипция (RT-PCR). В растителен сок се наблю= 076;ават изометричнl= 0; частици с диаметър около 30 нм. Проучванитk= 7; изолати са серологичнl= 6; далечно родствени н = 72; краставичнl= 6;мозаичния вирус (CMV), но пр= 080; ELISA и имуноелектl= 8;офореза показват тясно родство с кукумовируl= 9; от Китай, означен кат = 86; Ch 39. Българскитk= 7; изолати са определени като кукумовируl= 9; Ch 39-BG. Електрофо&#= 1088;етичният анализ на този вирус п= 086;казва присъствие на две белтъчни линии. При използване на праймери за CMV се амплиф= ;ицира неспецифичk= 7;н ДНК фрагмен = 90; с дължина 500 bp. Всички проведени изследваниn= 3; предполагаm= 0; наличие на кукумовируl= 9;, по-близък до CM= V, макар и различен от известните щамове на вируса.

AS	Isolate Nо 75	Isolate Nо 77
Attraction	Decoration	Attraction	Decoration
AS 52 - BBMV	30 particles per field	few particles, no decoration	25 particles per field	few particles, no decoration
AS 263 - BMV	100 particles per field	20 particles per field, no decoration	92 particles per field	20 particles per field, no decoration
AS 287 - MYFV=	10 particles per field	virus is seen, no decoration	10 particles per field	virus is seen, no decoration
AS 326 - CMV<= /span>	20 particles per field	virus is seen, no decoration	15 particles per field	virus is seen, no decoration
AS 229 - BBSV	-	-	-	-
AS 157 - SBMV	-	-	-	-
Control with buffer	400 particles per field	-	320 particles per field	-

Isolates<= /span>	C. qui-noa	C. ama-ranticolor	P .vulgaris cv .D. Witte	N. bentha- miana	N. cle-velandii	N. glu-tinosa	N. tabacum cv. W. Burley	G. glo-bosa
75	*/YS	*/YS	DCS E/ St M	DCS/M	DCS/M	SNS/M St	SNS/M St	SNS/M St
77	*/YS	ns/YS	DCS E/ St M	ns/M LD E<= /o:p>	n.t.	ns/M LD	CRS/M Bls=	RNS/ RNS LD
113	*/YSp	*/YSp	DCS E/ St M	ns/M St	ns/M	SCRS/ LD FF	CRS/ns	n.t.
CMV control	CLL/ns	CLL/ns	DCS E/M	ns/M	ns/M	ns/M	n.t.	ns/ns

Isolates<= /span>	D. stramonium	P. hybrida	L. esculentum	C. annuum	C. sativus	P. sativum	V. faba
75	n.t.	NS/M St= Y	ns/YS	DCS LA/Mo=	ns/ns	ns/ns	SBN
77	n.t.	n.t.	ns/ns	ns/ns	ns/ns	Chl/LC LD St W	SBN
113	n.t.	n.t.	ns/ns	ns/ns	ns/ns	Chl/LC LD W	SBN
CMV control=	DCS/SCS	n.t.	ns/ns	ns/ns	ns/M	ns/ns	n.t.

Isolates	PTA-ELISA (PAb)=	= DAS-ELISA (PAbs)	= TAS-ELISA* (MAbs)
AS 326	AS ALS	AS = S4	M85=	M172	Agdia
= 75	+	-	-	-	-	-
= 77	+	-	-	-	-	-
= 113	+	-	-	-	-	-
= Positive = CMV control	+++	++	+++	++	++	+++

Isolates=	PTA-ELISA	DAS-ELISA	TAS-ELISA*
AS Ch 39=	CMV AS 326	AS Ch 39=	CMV MAb 2+185
75=	+++	++	++	-
77=	+++	+	++	-
Positive CMV control	+++	+++	-	++++